Stem-loop sequence gga-mir-187

AccessionMI0001193 (change log)
DescriptionGallus gallus miR-187 stem-loop
Gene family MIPF0000078; mir-187
Literature search

3 open access papers mention gga-mir-187
(6 sentences)

Stem-loop
   aaacuau    aga    c    a                a c  u 
5'        ugug   ccuc ggcu caacacaggacauggg g uu u
          ||||   |||| |||| |||||||||||||||| | ||  
3'        acac   ggag ccga guuguguucugugcuc c ag c
   -------    -gg    a    c                c a  u 
Get sequence
Deep sequencing
69510 reads, 540 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 83889612-83889697 [+]
intergenic
Database links

Mature sequence gga-miR-187-5p

Accession MIMAT0026507
Sequence

20 - 

ggcuacaacacaggacauggga

 - 41

Get sequence
Deep sequencing13632 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-187-3p

Accession MIMAT0001124
Sequence

56 - 

ucgugucuuguguugcagcc

 - 75

Get sequence
Deep sequencing55868 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).