Stem-loop sequence gga-mir-138-1

AccessionMI0001191 (change log)
DescriptionGallus gallus miR-138-1 stem-loop
Gene family MIPF0000075; mir-138
Literature search

5 open access papers mention gga-mir-138-1
(12 sentences)

Stem-loop
   cccugccg     c    a  ag             uca      - a  a 
5'         ggugc gugc gc  cugguguugugaa   ggccgu c cc g
           ||||| |||| ||  |||||||||||||   |||||| | ||  
3'         ccacg cacg ug  gaccacaacacuu   ucggca g gg u
   -----aca     u    g  -g             -ca      a a  c 
Get sequence
Deep sequencing
45500 reads, 560 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 40874171-40874266 [-]
intergenic
Database links

Mature sequence gga-miR-138-5p

Accession MIMAT0001122
Sequence

22 - 

agcugguguugugaauc

 - 38

Get sequence
Deep sequencing85932 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-138-1-3p

Accession MIMAT0026505
Sequence

64 - 

uacuucacaacaccagggug

 - 83

Get sequence
Deep sequencing2408 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).