Stem-loop sequence gga-mir-148a

Accession MI0001189
Description Gallus gallus miR-148a stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  ag            --a    ca    -   gu 
ga  caaaguucugug   cacu  gacu cug  u
||  ||||||||||||   ||||  |||| |||  a
cu  guuucaagacau   guga  cuga gau  c
  cu            cac    --    c   ag 
Get sequence
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr2: 32253587-32253654 [-]
sense
Database links

Mature sequence gga-miR-148a

Accession MIMAT0001120
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Evidence by similarity; MI0000253
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).