Stem-loop sequence gga-mir-153

AccessionMI0001188 (change log)
DescriptionGallus gallus miR-153 stem-loop
Gene family MIPF0000050; mir-153
Literature search

2 open access papers mention gga-mir-153
(5 sentences)

Stem-loop
   a      g      -             gu       -a  aa 
5'  gcgguu ccagug ucauuuuugugau  ugcagcu  gu  u
    |||||| |||||| |||||||||||||  |||||||  ||  a
3'  ugucaa gguuac agugaaaacacug  acguuga  cg  u
   g      a      u             au       cc  ag 
Get sequence
Deep sequencing
38103 reads, 300 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 8846565-8846651 [-]
sense
ENSGALT00000010500 ; PTPRN2-201; intron 19
Database links

Mature sequence gga-miR-153-5p

Accession MIMAT0026502
Sequence

15 - 

ucauuuuugugauguugcagcu

 - 36

Get sequence
Deep sequencing817 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-153-3p

Accession MIMAT0001119
Sequence

53 - 

uugcauagucacaaaaguga

 - 72

Get sequence
Deep sequencing37284 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).