Stem-loop sequence gga-mir-17

AccessionMI0001184 (change log)
DescriptionGallus gallus miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

19 open access papers mention gga-mir-17
(102 sentences)

Stem-loop
        a       -ca        a  g     gua  gaua 
5' gucag guaaugu   aagugcuu ca ugcag   gu    u
   ||||| |||||||   |||||||| || |||||   ||     
3' caguu uauuacg   uucacgga gu acguc   ca    a
        g       aug        a  g     auc  agau 
Get sequence
Deep sequencing
80145 reads, 1e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 148023974-148024058 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-17
gga-mir-17chr1: 148023974-148024058 [-]
gga-mir-18achr1: 148023819-148023911 [-]
gga-mir-19achr1: 148023685-148023765 [-]
gga-mir-20achr1: 148023499-148023596 [-]
gga-mir-19bchr1: 148023376-148023462 [-]
gga-mir-92-1chr1: 148023263-148023340 [-]
Database links

Mature sequence gga-miR-17-5p

Accession MIMAT0001114
Sequence

14 - 

caaagugcuuacagugcagguagu

 - 37

Get sequence
Deep sequencing73638 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence gga-miR-17-3p

Accession MIMAT0001115
Sequence

52 - 

acugcagugaaggcacuugu

 - 71

Get sequence
Deep sequencing6500 reads, 5 experiments
Evidence by similarity; MI0000071
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).