Stem-loop sequence gga-mir-19b

AccessionMI0001180 (change log)
DescriptionGallus gallus miR-19b stem-loop
Gene family MIPF0000011; mir-19
Literature search

9 open access papers mention gga-mir-19b
(52 sentences)

Stem-loop
          cuc              -  -      uc    --u     
5' cacuguu   ugguuaguuuugca gg uuugca  cagc   guau 
   |||||||   |||||||||||||| || ||||||  ||||   ||| g
3' gugacgg   gucagucaaaacgu cc aaacgu  gucg   caua 
          --u              a  u      --    ucu     
Get sequence
Deep sequencing
13465 reads, 220 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 148023376-148023462 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-19b
gga-mir-17chr1: 148023974-148024058 [-]
gga-mir-18achr1: 148023819-148023911 [-]
gga-mir-19achr1: 148023685-148023765 [-]
gga-mir-20achr1: 148023499-148023596 [-]
gga-mir-19bchr1: 148023376-148023462 [-]
gga-mir-92-1chr1: 148023263-148023340 [-]
Database links

Mature sequence gga-miR-19b-5p

Accession MIMAT0026496
Sequence

16 - 

aguuuugcagguuugcauccagc

 - 38

Get sequence
Deep sequencing37 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-19b-3p

Accession MIMAT0001110
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing26848 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).