Stem-loop sequence gga-mir-221

AccessionMI0001178 (change log)
DescriptionGallus gallus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

23 open access papers mention gga-mir-221
(141 sentences)

Stem-loop
   gacug       uugg  cau     ug   u         auuu    -   u 
5'      uccaggu    gg   gaacc  gca acaauguag    cugu guu g
        |||||||    ||   |||||  ||| |||||||||    |||| ||| u
3'      agguccg    cc   uuugg  cgu uguuacauc    gaca cga u
   ----a       ucga  ---     gu   c         ----    a   a 
Get sequence
Deep sequencing
117971 reads, 960 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 110650534-110650632 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-221
gga-mir-222achr1: 110650030-110650127 [+]
gga-mir-221chr1: 110650534-110650632 [+]
Database links

Mature sequence gga-miR-221-5p

Accession MIMAT0026494
Sequence

23 - 

aaccuggcauacaauguagauuucugu

 - 49

Get sequence
Deep sequencing18919 reads, 5 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-221-3p

Accession MIMAT0001108
Sequence

64 - 

agcuacauugucugcuggguuuc

 - 86

Get sequence
Deep sequencing99052 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).