Stem-loop sequence gga-mir-222a

AccessionMI0001177 (change log)
Previous IDsgga-mir-222a;gga-mir-222;gga-mir-222-1
DescriptionGallus gallus miR-222a stem-loop
Gene family MIPF0000051; mir-221
Literature search

18 open access papers mention gga-mir-222a
(161 sentences)

Stem-loop
   -----  u  u  cc     auc             -     auu   ucuu 
5'      ug ag ug  cauca   gcucaguagucag uguag   cug    u
        || || ||  |||||   ||||||||||||| |||||   |||     
3'      ac uc ac  guagu   ugggucaucgguc acauc   gac    a
   ucuau  -  u  -a     cuc             u     gac   uaac 
Get sequence
Deep sequencing
49632 reads, 300 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 110650030-110650127 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-222a
gga-mir-222achr1: 110650030-110650127 [+]
gga-mir-221chr1: 110650534-110650632 [+]
Database links

Mature sequence gga-miR-222

Accession MIMAT0001107
Sequence

57 - 

agcuacaucuggcuacugggucuc

 - 80

Get sequence
Deep sequencing81242 reads, 5 experiments
Evidence experimental;

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).