Stem-loop sequence gga-mir-155

AccessionMI0001176 (change log)
DescriptionGallus gallus miR-155 stem-loop
Gene family MIPF0000157; mir-155
Literature search

37 open access papers mention gga-mir-155
(419 sentences)

Stem-loop
   u           u    a        -    c 
5'  guuaaugcuaa cgug uagggguu uuua c
    ||||||||||| |||| |||||||| ||||  
3'  caauuacgauu guac auccucag aagu u
   a           -    -        u    c 
Get sequence
Deep sequencing
4076 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 102485099-102485161 [+]
intergenic
Database links

Mature sequence gga-miR-155

Accession MIMAT0001106
Sequence

3 - 

uuaaugcuaaucgugauagggg

 - 24

Get sequence
Deep sequencing4075 reads, 5 experiments
Evidence by similarity; MI0000681
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).