Stem-loop sequence gga-mir-125b-2

AccessionMI0001175 (change log)
Previous IDsgga-mir-125b
DescriptionGallus gallus miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

27 open access papers mention gga-mir-125b-2
(64 sentences)

Stem-loop
   a  aga   uu     uc  ug   c   a        ----g   u 
5'  uc   cuu  ccuag  cc  aga ccu acuuguga     guu u
    ||   |||  |||||  ||  ||| ||| ||||||||     |||  
3'  ag   gag  ggauc  gg  ucu gga ugaacacu     cga g
   -  -gg   gc     ca  gu   c   c        aacaa   u 
Get sequence
Deep sequencing
659613 reads, 7.22e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 99051079-99051168 [+]
intergenic
Database links

Mature sequence gga-miR-125b-5p

Accession MIMAT0001105
Sequence

17 - 

ucccugagacccuaacuuguga

 - 38

Get sequence
Deep sequencing1220049 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence gga-miR-125b-3p

Accession MIMAT0026493
Sequence

57 - 

acaagucaggcucuugggaccu

 - 78

Get sequence
Deep sequencing49541 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).