Stem-loop sequence gga-mir-99a

AccessionMI0001173 (change log)
DescriptionGallus gallus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Literature search

8 open access papers mention gga-mir-99a
(18 sentences)

Stem-loop
   cca         a         uc   u       ugaa 
5'    auuggcaua acccguaga  cga cuugugu    a
      ||||||||| |||||||||  ||| |||||||    u
3'    ugacugugu uggguaucu  gcu gaacacg    g
   gua         c         uc   c       ucac 
Get sequence
Deep sequencing
1795338 reads, 2.25e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 99018041-99018121 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-99a
gga-mir-99achr1: 99018041-99018121 [+]
gga-let-7cchr1: 99018794-99018877 [+]
Database links

Mature sequence gga-miR-99a-5p

Accession MIMAT0001103
Previous IDsgga-miR-99a
Sequence

13 - 

aacccguagauccgaucuugug

 - 34

Get sequence
Deep sequencing1791027 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence gga-miR-99a-3p

Accession MIMAT0006781
Previous IDsgga-miR-99a*
Sequence

50 - 

caagcucgcuucuaugggucu

 - 70

Get sequence
Deep sequencing4311 reads, 5 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).