Stem-loop sequence gga-let-7b

AccessionMI0001172 (change log)
DescriptionGallus gallus let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

51 open access papers mention gga-let-7b
(401 sentences)

Stem-loop
       au                     ucaggguagugauuu 
5' cagg  gagguaguagguugugugguu               u
   ||||  |||||||||||||||||||||                
3' gucc  uuccgucauccaacauaucaa               g
       -c                     uagaggacuaacccc 
Get sequence
Deep sequencing
8829252 reads, 1.02e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 71292310-71292394 [+]
sense
ENSGALT00000028948 ; gga-let-7b-201; exon 1
AADN04003343.1: 13389-13473 [-]
sense
ENSGALT00000028948 ; gga-let-7b-201; exon 1
Clustered miRNAs
< 10kb from gga-let-7b
gga-let-7a-3chr1: 71291481-71291556 [+]
gga-let-7bchr1: 71292310-71292394 [+]
Database links

Mature sequence gga-let-7b

Accession MIMAT0001102
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Deep sequencing8829103 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.