Stem-loop sequence gga-mir-33-1

AccessionMI0001170 (change log)
Previous IDsgga-mir-33
DescriptionGallus gallus miR-33 stem-loop
Gene family MIPF0000070; mir-33
Literature search

8 open access papers mention gga-mir-33-1
(120 sentences)

Stem-loop
        g          uu         --g   u 
5' cugua ugcauuguag  gcauugcau   ugc g
   ||||| ||||||||||  |||||||||   ||| g
3' gacau acgugacguc  uguaacgug   aug c
        g          cu         uca   a 
Get sequence
Deep sequencing
37396 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 49529873-49529941 [-]
sense
ENSGALT00000019442 ; SREBF2-201; intron 16
Database links

Mature sequence gga-miR-33-5p

Accession MIMAT0001100
Sequence

6 - 

gugcauuguaguugcauugc

 - 25

Get sequence
Deep sequencing36742 reads, 5 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-33-3p

Accession MIMAT0026490
Sequence

47 - 

aauguuccugcagugcagua

 - 66

Get sequence
Deep sequencing572 reads, 5 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).