Stem-loop sequence gga-mir-135a-2

AccessionMI0001169 (change log)
DescriptionGallus gallus miR-135a-2 stem-loop
Gene family MIPF0000028; mir-135
Literature search

8 open access papers mention gga-mir-135a-2
(10 sentences)

Stem-loop
   a   aaa     ucua                u            u g a 
5'  gau   uucac    guguuuuauggcuuuu auuccuauguga a u a
    |||   |||||    |||||||||||||||| |||||||||||| | | u
3'  cua   aagug    cauaaaguaccgaagg uagggauguacu u a a
   a   -aa     -uua                -            c g a 
Get sequence
Deep sequencing
27674 reads, 200 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 46334585-46334684 [+]
sense
ENSGALT00000028945 ; gga-mir-135a-2-201; exon 1
Database links

Mature sequence gga-miR-135a-5p

Accession MIMAT0001099
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing75830 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-135a-2-3p

Accession MIMAT0026489
Sequence

61 - 

auguagggauggaagccaugaa

 - 82

Get sequence
Deep sequencing2393 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).