Stem-loop sequence gga-mir-29b-1

AccessionMI0001167 (change log)
DescriptionGallus gallus miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Literature search

14 open access papers mention gga-mir-29b-1
(55 sentences)

Stem-loop
       -     -          u      gu      uuaac 
5' ccuc aggaa gcugguuuca auggug  uuagau     u
   |||| ||||| |||||||||| ||||||  ||||||     a
3' ggag uucuu ugacuaaagu uaccac  gaucug     u
       g     g          u      --      uuacu 
Get sequence
Deep sequencing
71573 reads, 660 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 3433759-3433839 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-29b-1
gga-mir-29b-1chr1: 3433759-3433839 [+]
gga-mir-29achr1: 3434776-3434864 [+]
Database links

Mature sequence gga-miR-29b-1-5p

Accession MIMAT0026488
Sequence

9 - 

agcugguuucauauggugguuuaga

 - 33

Get sequence
Deep sequencing2090 reads, 5 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-29b-3p

Accession MIMAT0001097
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing139071 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).