Stem-loop sequence gga-mir-29a

AccessionMI0001166 (change log)
DescriptionGallus gallus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

16 open access papers mention gga-mir-29a
(31 sentences)

Stem-loop
   a    uu agagg            uuu       c    ucaa 
5'  cccc  u     augacugauuuc   ugguguu agag    u
    ||||  |     ||||||||||||   ||||||| ||||    a
3'  gggg  a     uauuggcuaaag   accacga ucuu    a
   a    uu -guga            uuu       -    uuau 
Get sequence
Deep sequencing
72420 reads, 660 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 3434776-3434864 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-29a
gga-mir-29b-1chr1: 3433759-3433839 [+]
gga-mir-29achr1: 3434776-3434864 [+]
Database links

Mature sequence gga-miR-29a-5p

Accession MIMAT0026487
Sequence

18 - 

cugauuucuuuugguguucaga

 - 39

Get sequence
Deep sequencing1647 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-29a-3p

Accession MIMAT0001096
Sequence

55 - 

uagcaccauuugaaaucgguu

 - 75

Get sequence
Deep sequencing70772 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).