Stem-loop sequence mmu-mir-370

Accession MI0001165
Symbol MGI:Mir370
Description Mus musculus miR-370 stem-loop
Gene family MIPF0000167; mir-370
Stem-loop 
       g         ca gu   u    u   a  g 
agacgga agaccaggu  c  cuc gcag uac ca c
||||||| |||||||||  |  ||| |||| ||| || u
ucugucu uuuggucca  g  ggg cguc gug gu c
       g         ag ug   u    c   a  a
Get sequence
Deep sequencing
14771 reads, 47 experiments
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 109618258-109618336 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-370
mmu-mir-341 chr12: 109611500-109611595 [+]
mmu-mir-1188 chr12: 109611822-109611941 [+]
mmu-mir-370 chr12: 109618258-109618336 [+]
Database links

Mature sequence mmu-miR-370-5p

Accession MIMAT0017174
Previous IDs mmu-miR-370*
Sequence

13 -  

caggucacgucucugcaguu

 - 32

Get sequence
Deep sequencing 2134 reads, 36 experiments
Evidence experimental; 454 [5], Solexa [6]
Predicted targets

Mature sequence mmu-miR-370-3p

Accession MIMAT0001095
Previous IDs mmu-miR-370
Sequence

48 -  

gccugcugggguggaaccuggu

 - 69

Get sequence
Deep sequencing 12628 reads, 43 experiments
Evidence experimental; PCR [1], cloned [2-3], Solexa [4,6]
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).