Stem-loop sequence mmu-mir-370

AccessionMI0001165 (change log)
Symbol MGI:Mir370
DescriptionMus musculus miR-370 stem-loop
Gene family MIPF0000167; mir-370
Stem-loop
          g         ca gu   u    u   a  g 
5' agacgga agaccaggu  c  cuc gcag uac ca c
   ||||||| |||||||||  |  ||| |||| ||| || u
3' ucugucu uuuggucca  g  ggg cguc gug gu c
          g         ag ug   u    c   a  a 
Get sequence
Deep sequencing
9649 reads, 110 reads per million, 42 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109618258-109618336 [+]
sense
OTTMUST00000113329 ; Rian-012; intron 2
OTTMUST00000113328 ; Rian-010; intron 3
ENSMUST00000182689 ; Rian-012; intron 2
ENSMUST00000183215 ; Rian-010; intron 3
Clustered miRNAs
< 10kb from mmu-mir-370
mmu-mir-341chr12: 109611500-109611595 [+]
mmu-mir-1188chr12: 109611822-109611941 [+]
mmu-mir-370chr12: 109618258-109618336 [+]
Database links

Mature sequence mmu-miR-370-5p

Accession MIMAT0017174
Previous IDsmmu-miR-370*
Sequence

13 - 

caggucacgucucugcaguu

 - 32

Get sequence
Deep sequencing1350 reads, 34 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

Mature sequence mmu-miR-370-3p

Accession MIMAT0001095
Previous IDsmmu-miR-370
Sequence

48 - 

gccugcugggguggaaccuggu

 - 69

Get sequence
Deep sequencing8298 reads, 40 experiments
Evidence experimental; PCR [1], cloned [2-3], Illumina [4,6]
Database links
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).