|
miRBase |
|
Stem-loop sequence mmu-mir-412 |
|||||
| Accession | MI0001164 | ||||
| Symbol | MGI:Mir412 | ||||
| Description | Mus musculus miR-412 stem-loop | ||||
| Gene family | MIPF0000192; mir-412 | ||||
| Stem-loop |
g g a c c aa - u ggguau g acgg uggu gaccag ugg agua auug u |||||| | |||| |||| |||||| ||| |||| |||| cccgug c ugcc auca cugguc acu ucau uaau u g - g c c -- g c |
||||
| Deep sequencing |
| ||||
| Comments |
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-412-5p |
|
| Accession | MIMAT0017173 |
| Sequence |
15 - uggucgaccagcuggaaaguaau - 37 |
| Deep sequencing | 1557 reads, 33 experiments |
| Evidence | experimental; Solexa [5] |
| Predicted targets |
|
Mature sequence mmu-miR-412-3p |
|
| Accession | MIMAT0001094 |
| Previous IDs | mmu-miR-412 |
| Sequence |
52 - uucaccugguccacuagccg - 71 |
| Deep sequencing | 641 reads, 30 experiments |
| Evidence | experimental; PCR [1], cloned [2-3], Solexa [4-5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|