Stem-loop sequence mmu-mir-412

Accession MI0001164
Symbol MGI:Mir412
Description Mus musculus miR-412 stem-loop
Gene family MIPF0000192; mir-412
Stem-loop
      g g    a    c      c   aa    -    u 
ggguau g acgg uggu gaccag ugg  agua auug u
|||||| | |||| |||| |||||| |||  |||| ||||  
cccgug c ugcc auca cugguc acu  ucau uaau u
      g -    g    c      c   --    g    c 
Get sequence
Deep sequencing
2198 reads, 35 experiments
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 109743289-109743368 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-412
mmu-mir-382 chr12: 109733771-109733846 [+]
mmu-mir-134 chr12: 109734139-109734209 [+]
mmu-mir-668 chr12: 109734732-109734797 [+]
mmu-mir-485 chr12: 109734902-109734974 [+]
mmu-mir-453 chr12: 109735619-109735700 [+]
mmu-mir-154 chr12: 109738433-109738498 [+]
mmu-mir-496a chr12: 109739119-109739197 [+]
mmu-mir-377 chr12: 109740510-109740577 [+]
mmu-mir-541 chr12: 109742409-109742498 [+]
mmu-mir-409 chr12: 109743158-109743236 [+]
mmu-mir-412 chr12: 109743289-109743368 [+]
mmu-mir-369 chr12: 109743418-109743496 [+]
mmu-mir-410 chr12: 109743715-109743795 [+]
mmu-mir-3072 chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-412-5p

Accession MIMAT0017173
Sequence

15 - 

uggucgaccagcuggaaaguaau

 - 37

Get sequence
Deep sequencing 1557 reads, 33 experiments
Evidence experimental; Solexa [5]
Predicted targets

Mature sequence mmu-miR-412-3p

Accession MIMAT0001094
Previous IDs mmu-miR-412
Sequence

52 - 

uucaccugguccacuagccg

 - 71

Get sequence
Deep sequencing 641 reads, 30 experiments
Evidence experimental; PCR [1], cloned [2-3], Solexa [4-5]
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).