|
miRBase |
|
Stem-loop sequence mmu-mir-376b |
|||||
| Accession | MI0001162 | ||||
| Symbol | MGI:Mir376b | ||||
| Description | Mus musculus miR-376b stem-loop | ||||
| Gene family | MIPF0000091; mir-368 | ||||
| Stem-loop |
u u a u cgug u gguauu aaaagguggau uuccu cuaugguua cu c |||||| ||||||||||| ||||| ||||||||| || cuauga uuuuucaccua aagga gauacuaau gg c a c c - ---a u |
||||
| Deep sequencing |
| ||||
| Comments |
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature miR-376b products have been shown to be modified by A to I edits [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-376b-5p |
|
| Accession | MIMAT0003388 |
| Previous IDs | mmu-miR-376b* |
| Sequence |
14 - guggauauuccuucuaugguua - 35 |
| Deep sequencing | 18720 reads, 45 experiments |
| Evidence | experimental; cloned [2,4], Solexa [5-6] |
| Predicted targets |
|
Mature sequence mmu-miR-376b-3p |
|
| Accession | MIMAT0001092 |
| Previous IDs | mmu-miR-376b |
| Sequence |
51 - aucauagaggaacauccacuu - 71 |
| Deep sequencing | 33446 reads, 55 experiments |
| Evidence | experimental; Northern [1], PCR [1], cloned [2,4], Solexa [5-6] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17322061
"Redirection of silencing targets by adenosine-to-inosine editing of miRNAs"
Science. 315:1137-1140(2007).
|
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|