Stem-loop sequence mmu-mir-410

AccessionMI0001161 (change log)
Symbol MGI:Mir410
DescriptionMus musculus miR-410 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   g    c       g    ug      a  a     - uuu 
5'  ggua uugagga aggu  ucugug ug guucg c   a
    |||| ||||||| ||||  |||||| || ||||| |   u
3'  ccau aacuuuu uccg  agacac au uaagc g   u
   a    -       g    gu      a  a     a uaa 
Get sequence
Deep sequencing
36988 reads, 396 reads per million, 54 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109743715-109743795 [+]
sense
OTTMUST00000113366 ; Mirg-004; exon 5
OTTMUST00000113367 ; Mirg-001; exon 6
OTTMUST00000113368 ; Mirg-005; exon 6
OTTMUST00000114051 ; Mirg-010; exon 10
OTTMUST00000114052 ; Mirg-009; exon 13
OTTMUST00000114049 ; Mirg-011; exon 15
ENSMUST00000182268 ; Mirg-004; exon 5
ENSMUST00000181543 ; Mirg-001; exon 6
ENSMUST00000183116 ; Mirg-005; exon 6
ENSMUST00000182185 ; Mirg-010; exon 10
ENSMUST00000182499 ; Mirg-009; exon 13
ENSMUST00000183144 ; Mirg-011; exon 15
Clustered miRNAs
< 10kb from mmu-mir-410
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-410-5p

Accession MIMAT0017172
Previous IDsmmu-miR-410*
Sequence

15 - 

agguugucugugaugaguucg

 - 35

Get sequence
Deep sequencing555 reads, 29 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

Mature sequence mmu-miR-410-3p

Accession MIMAT0001091
Previous IDsmmu-miR-410
Sequence

50 - 

aauauaacacagauggccugu

 - 70

Get sequence
Deep sequencing36433 reads, 53 experiments
Evidence experimental; Northern [1,3], PCR [1], cloned [2-4], insitu [3], Illumina [5,7]
Database links
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:16566924 "Identification of new central nervous system specific mouse microRNAs" Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T FEBS Lett. 580:2195-2200(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).