Stem-loop sequence mmu-mir-409

AccessionMI0001160 (change log)
Symbol MGI:Mir409
DescriptionMus musculus miR-409 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u     u       a    ac         -    - auc 
5'  gguac cggagag gguu  ccgagcaac uuug c   u
    ||||| ||||||| ||||  ||||||||| |||| |    
3'  cuaug gcuuuuc ccaa  ggcucguug aagc g   g
   a     -       c    gu         u    a gag 
Get sequence
Deep sequencing
24297 reads, 126 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the miR-409-5p [1]. The 3' end of miR-409-5p was not determined and is predicted based on a miRNA length of 23 nts. Landgraf et al. later confirm expression of mature miRNAs from both arms of the hairpin [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109743158-109743236 [+]
sense
OTTMUST00000113366 ; Mirg-004; intron 4
OTTMUST00000113367 ; Mirg-001; intron 4
OTTMUST00000113368 ; Mirg-005; intron 5
OTTMUST00000114051 ; Mirg-010; intron 9
OTTMUST00000114052 ; Mirg-009; intron 11
OTTMUST00000114049 ; Mirg-011; intron 13
ENSMUST00000182268 ; Mirg-004; intron 4
ENSMUST00000181543 ; Mirg-001; intron 4
ENSMUST00000183116 ; Mirg-005; intron 5
ENSMUST00000182185 ; Mirg-010; intron 9
ENSMUST00000182499 ; Mirg-009; intron 11
ENSMUST00000183144 ; Mirg-011; intron 13
antisense
ENSMUST00000175348 ; Gm24321-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-409
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-409-5p

Accession MIMAT0004746
Sequence

15 - 

agguuacccgagcaacuuugcau

 - 37

Get sequence
Deep sequencing10747 reads, 56 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-409-3p

Accession MIMAT0001090
Previous IDsmmu-miR-409
Sequence

47 - 

gaauguugcucggugaaccccu

 - 68

Get sequence
Deep sequencing13543 reads, 56 experiments
Evidence experimental; PCR [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).