Stem-loop sequence osa-MIR166j

AccessionMI0001158 (change log)
DescriptionOryza sativa miR166j stem-loop
Gene family MIPF0000004; MIR166
Literature search

70 open access papers mention osa-MIR166j
(261 sentences)

Stem-loop
   -uga       cu    a a       c   c         a        c 
5'     uccaugg  guug g ggaauga guc ggucugaag ucgccguc c
       |||||||  |||| | ||||||| ||| ||||||||| ||||||||  
3'     agguacu  cagu c ccuuacu cgg ccaggcuuc gguggcgg c
   ccca       --    a c       u   a         -        a 
Get sequence
Deep sequencing
37162 reads, 2.44e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR166j-5p

Accession MIMAT0022887
Sequence

21 - 

gaaugacguccggucugaaga

 - 41

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166j-3p

Accession MIMAT0001088
Previous IDsosa-miR166n
Sequence

64 - 

ucggaccaggcuucauucccc

 - 84

Get sequence
Deep sequencing34292 reads, 2 experiments
Evidence by similarity; MI0000203
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).