Stem-loop sequence osa-MIR166m

AccessionMI0001157 (change log)
DescriptionOryza sativa miR166m stem-loop
Gene family MIPF0000004; MIR166
Literature search

72 open access papers mention osa-MIR166m
(261 sentences)

Stem-loop
   cuc     u      ----ug  u      cuc          uu  uu         a   ---  u  u   guccuacaucacauuuuuuuuucuuuguucu 
5'    ugcuu gguggu      gc gauguu   gguuaagggg  ug  gucugguuc agg   cc cc gcu                               g
      ||||| ||||||      || ||||||   ||||||||||  ||  ||||||||| |||   || || |||                               a
3'    acgga cuacca      cg uuacga   ccaauuuccc  ac  cggaccagg ucc   gg gg cgg                               a
   --u     -      uaauug  u      ---          uu  uu         c   agu  u  u   uacguaguacguguguguguagguagucuuu 
Get sequence
Deep sequencing
36297 reads, 2.4e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 23045356-23045555 [+]
intergenic
Database links

Mature sequence osa-miR166m

Accession MIMAT0001087
Sequence

147 - 

ucggaccaggcuucauucccu

 - 167

Get sequence
Deep sequencing36263 reads, 2 experiments
Evidence by similarity; MI0000200
Database links

References

1