Stem-loop sequence osa-MIR167j

AccessionMI0001156 (change log)
DescriptionOryza sativa miR167j stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

83 open access papers mention osa-MIR167j
(246 sentences)

Stem-loop
   ---- ug ga   -     - cu a     c         -             -    uu c  u   --uu        ugaa 
5'     u  u  ugu gugca c  u agcag ugaagcugc cagcaugaucuga ucuu  g ga cuc    uuuuuauc    u
       |  |  ||| ||||| |  | ||||| ||||||||| ||||||||||||| ||||  | || |||    ||||||||     
3'     a  g  aca cacgu g  a ucguc acuuugacg gucgugcuagacu agaa  c cu ggg    aaagguag    a
   uuua gu uc   u     a cu a     u         c             u    -u -  u   uuau        uuga 
Get sequence
Deep sequencing
87013 reads, 5.86e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 32686068-32686227 [-]
intergenic
Database links

Mature sequence osa-miR167j

Accession MIMAT0001086
Sequence

26 - 

ugaagcugccagcaugaucug

 - 46

Get sequence
Deep sequencing86998 reads, 2 experiments
Evidence by similarity; MI0000208
Database links

References

1