Stem-loop sequence osa-MIR171i

AccessionMI0001155 (change log)
DescriptionOryza sativa miR171i stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

42 open access papers mention osa-MIR171i
(144 sentences)

Stem-loop
   ----uaaaa               c          -           auuacag  ac  c  c 
5'          agagguauuggcgug cucaauccga aggcauggcug       gc  cu ga c
            ||||||||||||||| |||||||||| |||||||||||       ||  || ||  
3'          ucucuauaacugcgc gaguuagguu uuuguaccgac       cg  ga cu g
   cuucguucc               c          c           ----gua  -c  u  a 
Get sequence
Deep sequencing
142 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 21191603-21191722 [+]
intergenic
Database links

Mature sequence osa-miR171i-5p

Accession MIMAT0022886
Sequence

8 - 

agguauuggcgugccucaauc

 - 28

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR171i-3p

Accession MIMAT0001085
Previous IDsosa-miR171i
Sequence

88 - 

ggauugagccgcgucaauauc

 - 108

Get sequence
Deep sequencing64 reads, 2 experiments
Evidence by similarity; MI0000214
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).