Stem-loop sequence mmu-mir-196b

AccessionMI0001151 (change log)
Symbol MGI:Mir196b
DescriptionMus musculus miR-196b stem-loop
Gene family MIPF0000031; mir-196
Literature search

50 open access papers mention mmu-mir-196b
(241 sentences)

Stem-loop
   -      uc      uu       u  c           ucca 
5'  aacugg  ggugau  agguagu uc uguuguuggga    c
    ||||||  ||||||  ||||||| || |||||||||||     
3'  uugacu  ucauua  uccguca ag acgacagcucu    c
   g      --      cu       c  c           cuuu 
Get sequence
Deep sequencing
603526 reads, 2.14e+03 reads per million, 90 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. Landgraf et al. confirm expression of miR-196b in mouse by cloning [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 52230081-52230165 [-]
sense
OTTMUST00000065045 ; Hoxa9-004; intron 1
OTTMUST00000065044 ; Hoxa9-003; exon 1
OTTMUST00000096394 ; Hoxa9-005; exon 1
ENSMUST00000154641 ; Hoxa9-004; intron 1
ENSMUST00000156540 ; Hoxa9-003; exon 1
ENSMUST00000174115 ; Hoxa9-005; exon 1
ENSMUST00000070779 ; 9930038K12Rik-201; exon 2
Database links

Mature sequence mmu-miR-196b-5p

Accession MIMAT0001081
Previous IDsmmu-miR-196b
Sequence

16 - 

uagguaguuuccuguuguuggg

 - 37

Get sequence
Deep sequencing601292 reads, 90 experiments
Evidence experimental; cloned [2], Illumina [3,5]
Database links
Predicted targets

Mature sequence mmu-miR-196b-3p

Accession MIMAT0017170
Previous IDsmmu-miR-196b*
Sequence

51 - 

ucgacagcacgacacugccuuc

 - 72

Get sequence
Deep sequencing2234 reads, 40 experiments
Evidence experimental; 454 [4], Illumina [5]
Database links
Predicted targets

References

1
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).