Stem-loop sequence hsa-mir-196b

AccessionMI0001150 (change log)
Symbol HGNC:MIR196B
DescriptionHomo sapiens miR-196b stem-loop
Gene family MIPF0000031; mir-196
Literature search

163 open access papers mention hsa-mir-196b
(795 sentences)

Stem-loop
   --     uc      uu       u  c           ucca 
5'   acugg  ggugau  agguagu uc uguuguuggga    c
     |||||  ||||||  ||||||| || |||||||||||     
3'   ugacu  ucauua  uccguca ag acgacagcucu    c
   gu     --      cu       c  c           cuuu 
Get sequence
Deep sequencing
704812 reads, 1.66e+03 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 27169480-27169563 [-]
sense
OTTHUMT00000134391 ; HOXA3-005; intron 1
OTTHUMT00000358709 ; HOXA3-007; intron 1
OTTHUMT00000134390 ; HOXA3-006; intron 1
OTTHUMT00000059534 ; HOXA4-001; intron 1
OTTHUMT00000358700 ; HOXA4-004; intron 1
OTTHUMT00000358710 ; HOXA3-008; intron 2
OTTHUMT00000473057 ; RP1-170O19.22-001; intron 2
ENST00000522788 ; HOXA3-005; intron 1
ENST00000521779 ; HOXA3-007; intron 1
ENST00000521401 ; HOXA3-006; intron 1
ENST00000360046 ; HOXA4-001; intron 1
ENST00000511914 ; HOXA4-004; intron 1
ENST00000428284 ; HOXA4-201; intron 1
ENST00000518451 ; HOXA3-008; intron 2
ENST00000467897 ; RP1-170O19.22-001; intron 2
antisense
OTTHUMT00000407129 ; HOXA-AS2-003; intron 3
ENST00000521159 ; HOXA-AS2-003; intron 3
Database links

Mature sequence hsa-miR-196b-5p

Accession MIMAT0001080
Previous IDshsa-miR-196b
Sequence

15 - 

uagguaguuuccuguuguuggg

 - 36

Get sequence
Deep sequencing702207 reads, 153 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-196b-3p

Accession MIMAT0009201
Previous IDshsa-miR-196b*
Sequence

50 - 

ucgacagcacgacacugccuuc

 - 71

Get sequence
Deep sequencing2602 reads, 118 experiments
Evidence experimental; 454 [4]
Database links
Predicted targets

References

1
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).