miRNA Entry for MI0001150

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

mir-196 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-196
Identifiers
Symbol	mir-196
Rfam	RF00256
miRBase	MI0000238
miRBase family	MIPF0000031
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553).^[1]^[2] miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin.

It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.^[3]

[edit] References

^ Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T (2003). "New microRNAs from mouse and human.". RNA 9 (2): 175–9. PMID 12554859.
^ Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP (2003). "Vertebrate microRNA genes.". Science 299 (5612): 1540. PMID 12624257.
^ Hu Z, Chen J, Tian T, Zhou X, Gu H, Xu L, Zeng Y, Miao R, Jin G, Ma H, Chen Y, Shen H (2008). "Genetic variants of miRNA sequences and non-small cell lung cancer survival". J Clin Invest 118 (7): 2600–8. doi:10.1172/JCI34934. PMC 2402113. PMID 18521189. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2402113/.

[edit] Further reading

^ Zhang XW, Pan SD, Feng YL, Liu JB, Dong J, Zhang YX, Chen JG, Hu ZB, Shen HB (2011). "[Relationship between genetic polymorphism in microRNAs precursor and genetic prediposition of hepatocellular carcinoma].". Zhonghua Yu Fang Yi Xue Za Zhi 45 (3): 239–43. PMID 21624236.
^ Georges M (2011). "The long and winding road from correlation to causation.". Nat Genet 43 (3): 180–1. doi:10.1038/ng0311-180. PMID 21350497.
^ Brest P, Lapaquette P, Souidi M, Lebrigand K, Cesaro A, Vouret-Craviari V, Mari B, Barbry P, Mosnier JF, Hébuterne X, Harel-Bellan A, Mograbi B, Darfeuille-Michaud A, Hofman P (2011). "A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM-dependent xenophagy in Crohn's disease.". Nat Genet 43 (3): 242–5. doi:10.1038/ng.762. PMID 21278745.
^ Chen C, Zhang Y, Zhang L, Weakley SM, Yao Q (2011). "MicroRNA-196: critical roles and clinical applications in development and cancer.". J Cell Mol Med 15 (1): 14–23. doi:10.1111/j.1582-4934.2010.01219.x. PMID 21091634.
^ Scagnolari C, Zingariello P, Vecchiet J, Selvaggi C, Racciatti D, Taliani G, Riva E, Pizzigallo E, Antonelli G (2010). "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha.". Virol J 7: 311. doi:10.1186/1743-422X-7-311. PMC 2996368. PMID 21070682. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2996368/.
^ Li Y, Zhang M, Chen H, Dong Z, Ganapathy V, Thangaraju M, Huang S (2010). "Ratio of miR-196s to HOXC8 messenger RNA correlates with breast cancer cell migration and metastasis.". Cancer Res 70 (20): 7894–904. doi:10.1158/0008-5472.CAN-10-1675. PMC 2955846. PMID 20736365. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2955846/.
^ Guan Y, Mizoguchi M, Yoshimoto K, Hata N, Shono T, Suzuki SO, Araki Y, Kuga D, Nakamizo A, Amano T, Ma X, Hayashi K, Sasaki T (2010). "MiRNA-196 is upregulated in glioblastoma but not in anaplastic astrocytoma and has prognostic significance.". Clin Cancer Res 16 (16): 4289–97. doi:10.1158/1078-0432.CCR-10-0207. PMID 20601442.
^ Asli NS, Kessel M (2010). "Spatiotemporally restricted regulation of generic motor neuron programs by miR-196-mediated repression of Hoxb8.". Dev Biol 344 (2): 857–68. doi:10.1016/j.ydbio.2010.06.003. PMID 20553899.
^ Schotte D, Lange-Turenhout EA, Stumpel DJ, Stam RW, Buijs-Gladdines JG, Meijerink JP, Pieters R, Den Boer ML (2010). "Expression of miR-196b is not exclusively MLL-driven but is especially linked to activation of HOXA genes in pediatric acute lymphoblastic leukemia.". Haematologica 95 (10): 1675–82. doi:10.3324/haematol.2010.023481. PMC 2948092. PMID 20494936. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2948092/.
^ Hou W, Tian Q, Zheng J, Bonkovsky HL (2010). "MicroRNA-196 represses Bach1 protein and hepatitis C virus gene expression in human hepatoma cells expressing hepatitis C viral proteins.". Hepatology 51 (5): 1494–504. doi:10.1002/hep.23401. PMC 2862129. PMID 20127796. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2862129/.
^ McGlinn E, Yekta S, Mansfield JH, Soutschek J, Bartel DP, Tabin CJ (2009). "In ovo application of antagomiRs indicates a role for miR-196 in patterning the chick axial skeleton through Hox gene regulation.". Proc Natl Acad Sci U S A 106 (44): 18610–5. doi:10.1073/pnas.0910374106. PMC 2773993. PMID 19846767. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2773993/.
^ Sehm T, Sachse C, Frenzel C, Echeverri K (2009). "miR-196 is an essential early-stage regulator of tail regeneration, upstream of key spinal cord patterning events.". Dev Biol 334 (2): 468–80. doi:10.1016/j.ydbio.2009.08.008. PMID 19682983.
^ Popovic R, Riesbeck LE, Velu CS, Chaubey A, Zhang J, Achille NJ, Erfurth FE, Eaton K, Lu J, Grimes HL, Chen J, Rowley JD, Zeleznik-Le NJ (2009). "Regulation of mir-196b by MLL and its overexpression by MLL fusions contributes to immortalization.". Blood 113 (14): 3314–22. doi:10.1182/blood-2008-04-154310. PMC 2665896. PMID 19188669. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2665896/.
^ Sonkoly E, Ståhle M, Pivarcsi A (2008). "MicroRNAs and immunity: novel players in the regulation of normal immune function and inflammation.". Semin Cancer Biol 18 (2): 131–40. doi:10.1016/j.semcancer.2008.01.005. PMID 18291670.
^ Woltering JM, Durston AJ (2008). "MiR-10 represses HoxB1a and HoxB3a in zebrafish.". PLoS ONE 3 (1): e1396. doi:10.1371/journal.pone.0001396. PMC 2148072. PMID 18167555. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2148072/.
^ Richardson MK, Crooijmans RP, Groenen MA (2007). "Sequencing and genomic annotation of the chicken (Gallus gallus) Hox clusters, and mapping of evolutionarily conserved regions.". Cytogenet Genome Res 117 (1-4): 110–9. doi:10.1159/000103171. PMID 17675851.
^ Kawasaki H, Taira K (2004). "MicroRNA-196 inhibits HOXB8 expression in myeloid differentiation of HL60 cells.". Nucleic Acids Symp Ser (Oxf) (48): 211–2. doi:10.1093/nass/48.1.211. PMID 17150553.
^ Chopra VS, Mishra RK (2006). ""Mir"acles in hox gene regulation.". Bioessays 28 (5): 445–8. doi:10.1002/bies.20401. PMID 16615131.
^ Ronshaugen M, Biemar F, Piel J, Levine M, Lai EC (2005). "The Drosophila microRNA iab-4 causes a dominant homeotic transformation of halteres to wings.". Genes Dev 19 (24): 2947–52. doi:10.1101/gad.1372505. PMC 1315399. PMID 16357215. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1315399/.
^ Hornstein E, Mansfield JH, Yekta S, Hu JK, Harfe BD, McManus MT, Baskerville S, Bartel DP, Tabin CJ (2005). "The microRNA miR-196 acts upstream of Hoxb8 and Shh in limb development.". Nature 438 (7068): 671–4. doi:10.1038/nature04138. PMID 16319892.
^ Yekta S, Shih IH, Bartel DP (2004). "MicroRNA-directed cleavage of HOXB8 mRNA.". Science 304 (5670): 594–6. doi:10.1126/science.1097434. PMID 15105502.

[edit] External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

Mature sequence hsa-miR-196b-5p
Accession	MIMAT0001080
Previous IDs	hsa-miR-196b
Sequence	15 - uagguaguuuccuguuguuggg - 36 Get sequence
Deep sequencing	8376 reads, 28 experiments
Evidence	experimental; cloned [2-3]
Validated targets	TARBASE:hsa-miR-196b-5p
Predicted targets	DIANA-MICROT:hsa-miR-196b-5p MICRORNA.ORG:hsa-miR-196b-5p MIRDB:hsa-miR-196b-5p RNA22-HSA:hsa-miR-196b-5p TARGETMINER:hsa-miR-196b-5p TARGETSCAN-VERT:hsa-miR-196b PICTAR-VERT:hsa-miR-196b

Mature sequence hsa-miR-196b-3p
Accession	MIMAT0009201
Previous IDs	hsa-miR-196b*
Sequence	50 - ucgacagcacgacacugccuuc - 71 Get sequence
Deep sequencing	43 reads, 14 experiments
Evidence	experimental; 454 [4]
Predicted targets	DIANA-MICROT:hsa-miR-196b-3p MICRORNA.ORG:hsa-miR-196b-3p MIRDB:hsa-miR-196b-3p RNA22-HSA:hsa-miR-196b-3p TARGETMINER:hsa-miR-196b-3p PICTAR-VERT:hsa-miR-196b

References
1	PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
2	PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3	PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4	PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).

miRBase

Stem-loop sequence hsa-mir-196b

[edit] References

[edit] Further reading

[edit] External links

Mature sequence hsa-miR-196b-5p

Mature sequence hsa-miR-196b-3p

References