Stem-loop sequence osa-MIR408

AccessionMI0001149 (change log)
DescriptionOryza sativa miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

48 open access papers mention osa-MIR408
(174 sentences)

Stem-loop
   ------------gggaguucugugauuggagaggagaggaga      u       a   u    u     uau      auguagauuauuccuugcacaagagaugauga 
5'                                           caggga gaggcag gca ggga ggggc   caacag                                u
                                             |||||| ||||||| ||| |||| |||||   ||||||                                 
3'                                           gucccu cuccguc cgu cccu ccucg   guuguu                                g
   ugugucucucucucucucucucucucuccacacguccccucg      u       a   c    c     -uu      guggucgguagagagucuugaguaagugucga 
Get sequence
Deep sequencing
892 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 12301661-12301873 [+]
intergenic
Database links

Mature sequence osa-miR408-5p

Accession MIMAT0022884
Sequence

31 - 

cagggaugaggcagagcaugg

 - 51

Get sequence
Deep sequencing838 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR408-3p

Accession MIMAT0001079
Previous IDsosa-miR408
Sequence

153 - 

cugcacugccucuucccuggc

 - 173

Get sequence
Deep sequencing40 reads, 2 experiments
Evidence by similarity; MI0001080
Database links

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).