Stem-loop sequence osa-MIR393b

AccessionMI0001148 (change log)
DescriptionOryza sativa miR393b stem-loop
Gene family MIPF0000083; MIR393
Literature search

51 open access papers mention osa-MIR393b
(126 sentences)

Stem-loop
   ucggccugaggaaacua u      c           c         u gc  -  -ua  -   a       cc 
5'                  g ggagga uccaaagggau gcauugauc g  ua gc   uc ucg ucgaucg  u
                    | |||||| ||||||||||| ||||||||| |  || ||   || ||| |||||||   
3'                  c ccuuuu agguuucccua cgugacuag c  gu cg   ag agc agcuagc  c
   ---------------uu u      a           a         - ua  g  ugc  c   -       ua 
Get sequence
Deep sequencing
334 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 34931876-34932007 [-]
intergenic
Database links

Mature sequence osa-miR393b-5p

Accession MIMAT0001078
Previous IDsosa-miR393b
Sequence

27 - 

uccaaagggaucgcauugaucu

 - 48

Get sequence
Deep sequencing209 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR393b-3p

Accession MIMAT0015123
Sequence

103 - 

ucagugcaaucccuuuggaau

 - 123

Get sequence
Deep sequencing114 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).