Stem-loop sequence osa-MIR171h

AccessionMI0001147 (change log)
DescriptionOryza sativa miR171h stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

44 open access papers mention osa-MIR171h
(150 sentences)

Stem-loop
   ----------a   -      g      uu        u             guu 
5'            gaa gaagag acaugg  ugguauug uucggcucauguc   c
              ||| |||||| ||||||  |||||||| |||||||||||||   a
3'            cuu cuucuu uguacu  acuauaac aagccgaguguag   c
   ucuucaagaga   a      a      -c        c             aca 
Get sequence
Deep sequencing
93 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 28482456-28482556 [+]
intergenic
Database links

Mature sequence osa-miR171h

Accession MIMAT0001077
Sequence

54 - 

gugagccgaaccaauaucacu

 - 74

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence by similarity; MI0000990
Database links

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).