Stem-loop sequence mmu-mir-384

AccessionMI0001146 (change log)
Symbol MGI:Mir384
DescriptionMus musculus miR-384 stem-loop
Gene family MIPF0000289; mir-384
Stem-loop
   u    aau    a     a       c     c    -ug   aa 
5'  guua   cagg auugu aacaauu cuagg aaug   uau  u
    ||||   |||| ||||| ||||||| ||||| ||||   |||  g
3'  caau   gucc uaaca uuguuaa gaucc uuac   aug  u
   a    ---    g     c       a     -    uga   gu 
Get sequence
Deep sequencing
6724 reads, 82.1 reads per million, 28 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 105344282-105344369 [-]
intergenic
Database links

Mature sequence mmu-miR-384-5p

Accession MIMAT0004745
Sequence

16 - 

uguaaacaauuccuaggcaaugu

 - 38

Get sequence
Deep sequencing1479 reads, 23 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-384-3p

Accession MIMAT0001076
Previous IDsmmu-miR-384
Sequence

57 - 

auuccuagaaauuguucacaau

 - 78

Get sequence
Deep sequencing5241 reads, 21 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).