Stem-loop sequence osa-MIR166i

AccessionMI0001144 (change log)
DescriptionOryza sativa miR166i stem-loop
Gene family MIPF0000004; MIR166
Literature search

70 open access papers mention osa-MIR166i
(263 sentences)

Stem-loop
   agaua     uu      c          a            -------      -g  -      --a       u 
5'      ggugu  ggaaug aguuugaucc agaucugccuau       auauau  gu guguau   ucauauc u
        |||||  |||||| |||||||||| ||||||||||||       ||||||  || ||||||   |||||||  
3'      ccaca  ccuuac ucggacuagg ucuagauggaug       ugugug  ca cguaua   gguauag g
   cauaa     cu      u          c            gggacag      ga  a      ggg       u 
Get sequence
Deep sequencing
29803 reads, 2.03e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 25294953-25295097 [+]
intergenic
Database links

Mature sequence osa-miR166i-5p

Accession MIMAT0022883
Sequence

15 - 

aaugcaguuugauccaagauc

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence osa-miR166i-3p

Accession MIMAT0001074
Previous IDsosa-miR166i
Sequence

115 - 

ucggaucaggcuucauuccuc

 - 135

Get sequence
Deep sequencing29799 reads, 2 experiments
Evidence by similarity; MI0000201
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).