Stem-loop sequence osa-MIR166g

AccessionMI0001142 (change log)
DescriptionOryza sativa miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

70 open access papers mention osa-MIR166g
(263 sentences)

Stem-loop
             cu         g   a   a     auugcuuggugcaaaauacuagggcauuguuguaag 
5' agcauggugu  ggaauggag cug ucc agauc                                    u
   ||||||||||  ||||||||| ||| ||| |||||                                    g
3' ucgugccaca  ccuuacuuc gac agg ucuag                                    c
             cu         g   c   c     gagcuauuguuugagccuuuguuuuuucuugauuac 
Get sequence
Deep sequencing
36881 reads, 2.43e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 18329367-18329511 [+]
intergenic
Database links

Mature sequence osa-miR166g-5p

Accession MIMAT0022881
Sequence

15 - 

aauggaggcugauccaagauc

 - 35

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166g-3p

Accession MIMAT0001072
Previous IDsosa-miR166g
Sequence

115 - 

ucggaccaggcuucauuccuc

 - 135

Get sequence
Deep sequencing36878 reads, 2 experiments
Evidence by similarity; MI0000201
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).