Stem-loop sequence osa-MIR172c

AccessionMI0001141 (change log)
DescriptionOryza sativa miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

77 open access papers mention osa-MIR172c
(455 sentences)

Stem-loop
      g    g                         gugccgcacggcacacguau 
5' cuu uugc ggugcagcgucaucaagauucacgu                    c
   ||| |||| |||||||||||||||||||||||||                    g
3' gag aacg ccacgucguaguaguucuaagugcg                    g
      a    a                         ugcuacugaugugaacuuuu 
Get sequence
Deep sequencing
5068 reads, 3.4e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR172 family [1]. It is predicted to target mRNAs coding for APETALA2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 13111485-13111595 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR172c
osa-MIR820bChr7: 13120534-13120734 [-]
osa-MIR172cChr7: 13111485-13111595 [-]
Database links

Mature sequence osa-miR172c

Accession MIMAT0001071
Sequence

81 - 

ugaaucuugaugaugcugcac

 - 101

Get sequence
Deep sequencing5068 reads, 2 experiments
Evidence by similarity; MI0000215
Database links

References

1