|
miRBase |
|
Stem-loop sequence osa-MIR171f |
||||||
| Accession | MI0001137 | |||||
| Description | Oryza sativa miR171f stem-loop | |||||
| Gene family | MIPF0000030; MIR171_1 | |||||
| Stem-loop |
g ag c a c acuagcuaagcaa g gag ug gauguuggcaugguucaauca accgggcaaa uuaugc g | ||| || ||||||||||||||||||||| |||||||||| |||||| a c uuc ac cuauaaccgugccgaguuagu ugguuuguuu gguaug u g ga a c u acguauagggacg |
|||||
| Deep sequencing |
| |||||
| Comments |
This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence osa-miR171f-5p |
|
| Accession | MIMAT0022880 |
| Sequence |
13 - uguuggcaugguucaaucaaa - 33 |
| Deep sequencing | 49 reads, 3 experiments |
| Evidence | experimental; Solexa [2] |
Mature sequence osa-miR171f-3p |
|
| Accession | MIMAT0001067 |
| Previous IDs | osa-miR171f |
| Sequence |
97 - ugauugagccgugccaauauc - 117 |
| Deep sequencing | 2431 reads, 4 experiments |
| Evidence | by similarity; MI0000214 |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
| 2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|