Stem-loop sequence osa-MIR171f

AccessionMI0001137 (change log)
DescriptionOryza sativa miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

45 open access papers mention osa-MIR171f
(169 sentences)

Stem-loop
    g   ag  c                     a          c      acuagcuaagcaa 
5' g gag  ug gauguuggcaugguucaauca accgggcaaa uuaugc             g
   | |||  || ||||||||||||||||||||| |||||||||| ||||||             a
3' c uuc  ac cuauaaccgugccgaguuagu ugguuuguuu gguaug             u
    g   ga  a                     c          u      acguauagggacg 
Get sequence
Deep sequencing
548 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 30027774-30027900 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR171f
osa-MIR443Chr3: 30021449-30021596 [+]
osa-MIR171fChr3: 30027774-30027900 [+]
Database links

Mature sequence osa-miR171f-5p

Accession MIMAT0022880
Sequence

13 - 

uguuggcaugguucaaucaaa

 - 33

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR171f-3p

Accession MIMAT0001067
Previous IDsosa-miR171f
Sequence

97 - 

ugauugagccgugccaauauc

 - 117

Get sequence
Deep sequencing545 reads, 2 experiments
Evidence by similarity; MI0000214
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).