Stem-loop sequence osa-MIR171e

AccessionMI0001136 (change log)
DescriptionOryza sativa miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

42 open access papers mention osa-MIR171e
(153 sentences)

Stem-loop
   -u    g   u         u       c     c     uggc    u  ---a       c 
5'   ggua cua gauguuggc cggcuca ucaga ggcau    guga gc    aagcaug a
     |||| ||| ||||||||| ||||||| ||||| |||||    |||| ||    |||||||  
3'   ucgu gau cuauaaccg gccgagu agucu uugug    cacu cg    uucgugc u
   uc    -   u         u       u     -     --uu    -  aucg       g 
Get sequence
Deep sequencing
589 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 1970487-1970605 [+]
intergenic
Database links

Mature sequence osa-miR171e-5p

Accession MIMAT0022879
Sequence

13 - 

uguuggcucggcucacucaga

 - 33

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR171e-3p

Accession MIMAT0001066
Previous IDsosa-miR171e
Sequence

89 - 

ugauugagccgugccaauauc

 - 109

Get sequence
Deep sequencing539 reads, 2 experiments
Evidence by similarity; MI0000214
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).