Stem-loop sequence osa-MIR171d

AccessionMI0001135 (change log)
DescriptionOryza sativa miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

44 open access papers mention osa-MIR171d
(145 sentences)

Stem-loop
   uugua   au         c       c     ----------    u   c g    -ga   g     ga 
5'      gcu  gauguuggc cggcuca ucaga          ugga cau g ugca   aga ugcau  a
        |||  ||||||||| ||||||| |||||          |||| ||| | ||||   ||| |||||  u
3'      cga  cuauaaccg gccgagu agucu          accu gua u augu   ucu acgua  c
   uacca   cu         u       u     ucaaggucgu    c   - g    gac   g     gu 
Get sequence
Deep sequencing
594 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 21237313-21237447 [+]
intergenic
Database links

Mature sequence osa-miR171d-5p

Accession MIMAT0022878
Sequence

13 - 

uguuggcccggcucacucaga

 - 33

Get sequence
Deep sequencing45 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR171d-3p

Accession MIMAT0001065
Previous IDsosa-miR171d
Sequence

105 - 

ugauugagccgugccaauauc

 - 125

Get sequence
Deep sequencing548 reads, 2 experiments
Evidence by similarity; MI0000214
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).