|
miRBase |
|
Stem-loop sequence osa-MIR171d |
|||||
| Accession | MI0001135 | ||||
| Description | Oryza sativa miR171d stem-loop | ||||
| Gene family | MIPF0000030; MIR171_1 | ||||
| Stem-loop |
uugua au c c ---------- u c g -ga g ga gcu gauguuggc cggcuca ucaga ugga cau g ugca aga ugcau a ||| ||||||||| ||||||| ||||| |||| ||| | |||| ||| ||||| u cga cuauaaccg gccgagu agucu accu gua u augu ucu acgua c uacca cu u u ucaaggucgu c - g gac g gu |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. |
||||
| Genome context |
|
||||
Mature sequence osa-miR171d-5p |
|
| Accession | MIMAT0022878 |
| Sequence |
13 - uguuggcccggcucacucaga - 33 |
| Deep sequencing | 218 reads, 3 experiments |
| Evidence | experimental; Solexa [2] |
Mature sequence osa-miR171d-3p |
|
| Accession | MIMAT0001065 |
| Previous IDs | osa-miR171d |
| Sequence |
105 - ugauugagccgugccaauauc - 125 |
| Deep sequencing | 2386 reads, 4 experiments |
| Evidence | by similarity; MI0000214 |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
| 2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|