Stem-loop sequence osa-MIR171c

AccessionMI0001134 (change log)
DescriptionOryza sativa miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

43 open access papers mention osa-MIR171c
(242 sentences)

Stem-loop
   gu  ga   g        ug             a  cuu u     gaa 
5'   gg  acg gauauugg  cgguucaaucaga ag   g gcucc   g
     ||  ||| ||||||||  ||||||||||||| ||   | |||||    
3'   cc  ugc cuauaacc  gccgaguuaguuu uc   c cgggg   g
   uu  gc   a        gu             c  -ac u     agc 
Get sequence
Deep sequencing
654 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 31713472-31713570 [-]
intergenic
Database links

Mature sequence osa-miR171c-5p

Accession MIMAT0022877
Sequence

10 - 

ggauauuggugcgguucaauc

 - 30

Get sequence
Deep sequencing109 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR171c-3p

Accession MIMAT0001064
Previous IDsosa-miR171c
Sequence

69 - 

ugauugagccgugccaauauc

 - 89

Get sequence
Deep sequencing545 reads, 2 experiments
Evidence by similarity; MI0000214
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).