|
miRBase |
|
Stem-loop sequence osa-MIR171c |
|||||
| Accession | MI0001134 | ||||
| Description | Oryza sativa miR171c stem-loop | ||||
| Gene family | MIPF0000030; MIR171_1 | ||||
| Stem-loop |
gu ga g ug a cuu u gaa gg acg gauauugg cgguucaaucaga ag g gcucc g || ||| |||||||| ||||||||||||| || | ||||| cc ugc cuauaacc gccgaguuaguuu uc c cgggg g uu gc a gu c -ac u agc |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. |
||||
| Genome context |
|
||||
Mature sequence osa-miR171c-5p |
|
| Accession | MIMAT0022877 |
| Sequence |
10 - ggauauuggugcgguucaauc - 30 |
| Deep sequencing | 391 reads, 4 experiments |
| Evidence | experimental; Solexa [2] |
Mature sequence osa-miR171c-3p |
|
| Accession | MIMAT0001064 |
| Previous IDs | osa-miR171c |
| Sequence |
69 - ugauugagccgugccaauauc - 89 |
| Deep sequencing | 2503 reads, 4 experiments |
| Evidence | by similarity; MI0000214 |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
| 2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|