Stem-loop sequence osa-MIR171b

AccessionMI0001133 (change log)
DescriptionOryza sativa miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

45 open access papers mention osa-MIR171b
(156 sentences)

Stem-loop
   ---      acgg        g               -  cuu u     gga 
5'    gcgacg    gauauugg gcgguucaaucagaa ag   g gcucc   a
      ||||||    |||||||| ||||||||||||||| ||   | |||||    
3'    cgcugc    cuauaacc ugccgaguuaguuuu uc   c cgagg   g
   cua      ---a        g               c  -au u     agc 
Get sequence
Deep sequencing
676 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 5369153-5369252 [+]
intergenic
Database links

Mature sequence osa-miR171b

Accession MIMAT0001063
Sequence

70 - 

ugauugagccgugccaauauc

 - 90

Get sequence
Deep sequencing545 reads, 2 experiments
Evidence by similarity; MI0000214
Database links

References

1