|
miRBase |
|
Stem-loop sequence osa-MIR171b |
|||||
| Accession | MI0001133 | ||||
| Description | Oryza sativa miR171b stem-loop | ||||
| Gene family | MIPF0000030; MIR171_1 | ||||
| Stem-loop |
--- acgg g - cuu u gga gcgacg gauauugg gcgguucaaucagaa ag g gcucc a |||||| |||||||| ||||||||||||||| || | ||||| cgcugc cuauaacc ugccgaguuaguuuu uc c cgagg g cua ---a g c -au u agc |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. |
||||
| Genome context |
|
||||
Mature sequence osa-miR171b |
|
| Accession | MIMAT0001063 |
| Sequence |
70 - ugauugagccgugccaauauc - 90 |
| Deep sequencing | 2503 reads, 4 experiments |
| Evidence | by similarity; MI0000214 |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|