Stem-loop sequence osa-MIR169p

AccessionMI0001131 (change log)
DescriptionOryza sativa miR169p stem-loop
Literature search

60 open access papers mention osa-MIR169p
(304 sentences)

Stem-loop
        a              caa         aucaacagagaaggacugccagucuccggc 
5' gagca gguguagccaagga   acuugccgg                              c
   ||||| ||||||||||||||   |||||||||                              a
3' cucgu cuacgucgguuccu   ugaacggcc                              a
        c              -ac         ggccgcuaccggcugccgcuccaauuaauu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 7641327-7641452 [-]
intergenic
Database links

Mature sequence osa-miR169p

Accession MIMAT0001061
Sequence

11 - 

uagccaaggacaaacuugccgg

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0000212

References

1