Stem-loop sequence osa-MIR169o

AccessionMI0001130 (change log)
DescriptionOryza sativa miR169o stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

60 open access papers mention osa-MIR169o
(324 sentences)

Stem-loop
   cu  -       -         u    u     c  uuuu   c  uguug  u     -   cgucuaucuaucugccauggcagauggc 
5'   cc cuuuggu agccaagaa gacu gccua gc    gcc uc     gc caucc auc                            a
     || ||||||| ||||||||| |||| ||||| ||    ||| ||     || ||||| |||                             
3'   gg gagaccg ucgguucuu cugg cgggu cg    cgg ag     cg guagg uag                            g
   -c  u       a         -    c     a  ---u   -  --uaa  u     a   uguucuuaaagaaagucuuugggaauua 
Get sequence
Deep sequencing
1348 reads, 800 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 6081528-6081700 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR169o
osa-MIR169nChr11: 6085252-6085428 [-]
osa-MIR169oChr11: 6081528-6081700 [-]
Database links

Mature sequence osa-miR169o

Accession MIMAT0001060
Sequence

11 - 

uagccaagaaugacuugccua

 - 31

Get sequence
Deep sequencing1343 reads, 2 experiments
Evidence by similarity; MI0000212
Database links

References

1