Stem-loop sequence osa-MIR169m

AccessionMI0001128 (change log)
DescriptionOryza sativa miR169m stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

61 open access papers mention osa-MIR169m
(310 sentences)

Stem-loop
   -ug  u  u   -         u    u        auuuau             u  gaucaauggauggau 
5'    ag cc ggu agccaagga gacu gccuguau      auauauaugugug gu               u
      || || ||| ||||||||| |||| ||||||||      ||||||||||||| ||               g
3'    uc gg ccg ucgguuccu cuga cggacaug      uauauauacguac cg               a
   cca  -  c   a         -    -        ------             u  gacguucgucgaacu 
Get sequence
Deep sequencing
5967 reads, 3.85e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 26813897-26814034 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR169m
osa-MIR169hChr8: 26807349-26807470 [+]
osa-MIR169mChr8: 26813897-26814034 [+]
osa-MIR169lChr8: 26817488-26817595 [+]
osa-MIR169qChr8: 26817488-26817595 [-]
Database links

Mature sequence osa-miR169m

Accession MIMAT0001058
Sequence

11 - 

uagccaaggaugacuugccug

 - 31

Get sequence
Deep sequencing5636 reads, 2 experiments
Evidence by similarity; MI0000212
Database links

References

1