Stem-loop sequence osa-MIR169j

AccessionMI0001125 (change log)
DescriptionOryza sativa miR169j stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

62 open access papers mention osa-MIR169j
(311 sentences)

Stem-loop
   -    a  u   -         u    u       ucucug u         -u  a  -a   ug 
5'  ucgc uc ggu agccaagga gacu gccugug      c caugugcag  ag ag  aga  c
    |||| || ||| ||||||||| |||| |||||||      | |||||||||  || ||  |||   
3'  ggcg ag ccg ucgguuccu cuga cggacac      g guauacguc  uc uc  ucu  a
   c    -  u   a         -    -       --ucua u         uu  g  ga   uu 
Get sequence
Deep sequencing
5961 reads, 3.85e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 19788861-19788985 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR169j
osa-MIR169jChr9: 19788861-19788985 [+]
osa-MIR169kChr9: 19792133-19792288 [+]
Database links

Mature sequence osa-miR169j

Accession MIMAT0001055
Sequence

11 - 

uagccaaggaugacuugccug

 - 31

Get sequence
Deep sequencing5637 reads, 2 experiments
Evidence by similarity; MI0000212
Database links

References

1