Stem-loop sequence osa-MIR169h

Accession MI0001123
Description Oryza sativa miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop 
uua    u   -         u    u       -uc     g  u          aauuau 
   gcuc ggu agccaagga gacu gccugug   cuugu ug aaggaucauu      u
   |||| ||| ||||||||| |||| |||||||   ||||| || ||||||||||      a
   ugag ccg ucgguuccu cuga cggguac   ggacg ac uuccuaguaa      u
uag    u   a         -    -       uuu     -  u          aagacu
Get sequence
Deep sequencing
9276 reads, 4 experiments
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 26807349-26807470 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR169h
osa-MIR169i Chr8: 26803116-26803291 [+]
osa-MIR169h Chr8: 26807349-26807470 [+]
osa-MIR169m Chr8: 26813897-26814034 [+]

Mature sequence osa-miR169h

Accession MIMAT0001053
Sequence

11 -  

uagccaaggaugacuugccug

 - 31

Get sequence
Deep sequencing 8534 reads, 4 experiments
Evidence by similarity; MI0000212

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).