Stem-loop sequence osa-MIR169h

AccessionMI0001123 (change log)
DescriptionOryza sativa miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

62 open access papers mention osa-MIR169h
(310 sentences)

Stem-loop
   uua    u   -         u    u       -uc     g  u          aauuau 
5'    gcuc ggu agccaagga gacu gccugug   cuugu ug aaggaucauu      u
      |||| ||| ||||||||| |||| |||||||   ||||| || ||||||||||      a
3'    ugag ccg ucgguuccu cuga cggguac   ggacg ac uuccuaguaa      u
   uag    u   a         -    -       uuu     -  u          aagacu 
Get sequence
Deep sequencing
5967 reads, 3.85e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 26807349-26807470 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR169h
osa-MIR169iChr8: 26803116-26803291 [+]
osa-MIR169hChr8: 26807349-26807470 [+]
osa-MIR169mChr8: 26813897-26814034 [+]
Database links

Mature sequence osa-miR169h

Accession MIMAT0001053
Sequence

11 - 

uagccaaggaugacuugccug

 - 31

Get sequence
Deep sequencing5637 reads, 2 experiments
Evidence by similarity; MI0000212
Database links

References

1