Stem-loop sequence osa-MIR169f

AccessionMI0001121 (change log)
DescriptionOryza sativa miR169f stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

63 open access papers mention osa-MIR169f
(316 sentences)

Stem-loop
   g             -           a     -          u   u    uaaugccuaugugcauguguuuauacgcugcucaucugcauuuugauuauccccu 
5'  ggccuuccaugag gacaagagcug uucgg uagccaagga gac ugcc                                                       g
    ||||||||||||| ||||||||||| ||||| |||||||||| ||| ||||                                                        
3'  ucggaaggugcuc cuguucucggc aggcu aucgguuccu cug acgg                                                       a
   g             u           g     u          u   u    auauauacauacucaugucucaugauguguguguauauuaacugcuguccugacu 
Get sequence
Deep sequencing
5670 reads, 3.65e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 18558299-18558512 [-]
intergenic
Database links

Mature sequence osa-miR169f.2

Accession MIMAT0020916
Sequence

11 - 

ugaggacaagagcugauucgg

 - 31

Get sequence
Deep sequencing64 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR169f.1

Accession MIMAT0001051
Previous IDsosa-miR169f
Sequence

32 - 

uagccaaggaugacuugccua

 - 52

Get sequence
Deep sequencing5606 reads, 2 experiments
Evidence by similarity; MI0000212

References

1
2