Stem-loop sequence osa-MIR169d

AccessionMI0001119 (change log)
DescriptionOryza sativa miR169d stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

60 open access papers mention osa-MIR169d
(310 sentences)

Stem-loop
   auuuau         aa      a           -----------u     uguu 
5'       cguguagcc  ggauga uugccggcguu            cacgc    g
         |||||||||  |||||| |||||||||||            |||||     
3'       guacaucgg  uuuacu aacggccgcgg            gugcg    a
   ccguuu         ac      g           uugaauauauac     uggu 
Get sequence
Deep sequencing
1233 reads, 750 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 14620382-14620484 [-]
intergenic
Database links

Mature sequence osa-miR169d

Accession MIMAT0001049
Sequence

11 - 

uagccaaggaugaauugccgg

 - 31

Get sequence
Deep sequencing1233 reads, 2 experiments
Evidence by similarity; MI0000212

References

1