Stem-loop sequence osa-MIR168a

AccessionMI0001115 (change log)
DescriptionOryza sativa miR168a stem-loop
Gene family MIPF0000081; MIR168
Literature search

70 open access papers mention osa-MIR168a
(256 sentences)

Stem-loop
     c   g gc             au     c   cc   g   c 
5' cg cuc g  ucgcuuggugcag  cggga ccg  gcc ccg u
   || ||| |  |||||||||||||  ||||| |||  ||| |||  
3' gc gag c  agugaaccacguu  gcccu ggc  cgg ggc g
     c   g ua             cc     a   --   -   c 
Get sequence
Deep sequencing
433102 reads, 2.98e+05 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR168 family [1]. It is predicted to target mRNAs coding for the ARGONAUTE protein.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 1553154-1553240 [-]
intergenic
Database links

Mature sequence osa-miR168a-5p

Accession MIMAT0001045
Previous IDsosa-miR168a
Sequence

11 - 

ucgcuuggugcagaucgggac

 - 31

Get sequence
Deep sequencing432603 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR168a-3p

Accession MIMAT0015122
Sequence

56 - 

gaucccgccuugcaccaagugaau

 - 79

Get sequence
Deep sequencing499 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).