Stem-loop sequence osa-MIR167f

AccessionMI0001111 (change log)
DescriptionOryza sativa miR167f stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

82 open access papers mention osa-MIR167f
(249 sentences)

Stem-loop
     ca  u               c          caca   gu       c ga  aug 
5' ca  ag ggaugaagcugccag augaucugau    gua  ucucuag u  ug   a
   ||  || ||||||||||||||| ||||||||||    |||  ||||||| |  ||    
3' gu  uc ucuacuuugacgguc uacuagacua    cgu  agagauc a  ac   u
     ac  u               -          ----   ac       c aa  auu 
Get sequence
Deep sequencing
86989 reads, 5.86e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR167 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 14723044-14723156 [-]
intergenic
Database links

Mature sequence osa-miR167f

Accession MIMAT0001041
Sequence

11 - 

ugaagcugccagcaugaucug

 - 31

Get sequence
Deep sequencing86976 reads, 2 experiments
Evidence by similarity; MI0000208
Database links

References

1