Stem-loop sequence osa-MIR167e

AccessionMI0001110 (change log)
DescriptionOryza sativa miR167e stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

82 open access papers mention osa-MIR167e
(249 sentences)

Stem-loop
   u        a         c             ugucaggcaugagccaaaucuauccaugguguuggugguacugaaauuaccgcguuuucgagguuuuucgucgugucaacuugcgaagggaauuacggguucu 
5'  gugagaga ugaagcugc agcaugaucuggu                                                                                                       u
    |||||||| ||||||||| |||||||||||||                                                                                                        
3'  cacucucu acuucgacg uuguacuagacua                                                                                                       g
   c        c         -             ccucgguuuaagguuagugaggguggagaaugacuuugaguguucuuguuaguauuaagauggagaugauugguucggguguggaggauagugguuacgagua 
Get sequence
Deep sequencing
87119 reads, 5.86e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR167 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 3742241-3742513 [-]
intergenic
Database links

Mature sequence osa-miR167e-5p

Accession MIMAT0001040
Previous IDsosa-miR167e
Sequence

11 - 

ugaagcugccagcaugaucug

 - 31

Get sequence
Deep sequencing86925 reads, 2 experiments
Evidence by similarity; MI0000208
Database links

Mature sequence osa-miR167e-3p

Accession MIMAT0022873
Sequence

245 - 

agaucauguugcagcuucacu

 - 265

Get sequence
Deep sequencing189 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).