Stem-loop sequence osa-MIR167d

AccessionMI0001109 (change log)
DescriptionOryza sativa miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

83 open access papers mention osa-MIR167d
(256 sentences)

Stem-loop
      u  g  c         -              gagugcuuauuaggugaggg 
5' cau ag ag ugaagcugc cagcaugaucugau                    c
   ||| || || ||||||||| ||||||||||||||                    a
3' gug uc uc acuuugacg gucguacuagacua                    g
      u  g  u         u              gaaacaaaaccgucaguuaa 
Get sequence
Deep sequencing
87000 reads, 5.86e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR167 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 4166295-4166404 [-]
intergenic
Database links

Mature sequence osa-miR167d-5p

Accession MIMAT0001039
Previous IDsosa-miR167d
Sequence

11 - 

ugaagcugccagcaugaucug

 - 31

Get sequence
Deep sequencing86991 reads, 2 experiments
Evidence by similarity; MI0000209
Database links

Mature sequence osa-miR167d-3p

Accession MIMAT0022872
Sequence

81 - 

gaucaugcugugcaguuucauc

 - 102

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).